EST 764187 is a singleton


Sequence

>764187 (1 EST) Length=262 AACCAGTTAACTATTTATTTATTGTTCAATCAAATAAACCGAATCCCATGTCATCGTCACTTTCTTCAGAANGGCACTTC AACAGGTGCAGCCTTTTCCTCTGCCTTGGTTGTAGTAGTTGGAGCCGGTGCGGCGGCAACCGTTGTAGTGACTGTAGCAT ATTTAGAAGGGATCTGCTAGGAACTCTTTAATCTGTTCGGNCCTCTTTGAACGAGTAATCGGTCATTAGAGACAAAGCCA ACAAGTTTTTTGNAGCCGTTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 764187: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7641871685503AA125684MLLG0240.M1FSchistosoma mansoni, lung stage


Date: 14:40:10 on Tue 21 Nov 117.