EST 764188 is a singleton


Sequence

>764188 (1 EST) Length=252 CTTAAAGCAAAGAAATATATATTTATTAGCTAGAATGCAAGCAGACACAGATTTTAGCATTAAAATAAGAAAGCATTCAG TACTACAACAGATAAAGTTCCGTAAGTTGAAAAAGTAATCGCTGATAGTTCGAACACAACAAGTCAGTCATTGACTGCAT ACATATGAAGCCTTTATAAGTTAACTTATTTCATTCACATTTGAAAACATATATCATAGGGTGCCCANCAGATTTCAGGG AAACACGGTTGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 764188: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7641881685504AA125685MLLG0247.M21FSchistosoma mansoni, lung stage


Date: 15:55:12 on Tue 21 Nov 117.