EST 779072 is a singleton


Sequence

>779072 (1 EST) Length=179 ATATGGAAAATATTTATTCATTATTCATAATATATATATTATTAAGTGTTCTTGATATCCTTAATTTTTCCAACTAATTT TTACTCAAAAACTAACAAATTTGCTTGAATCAAGAACGCCTAGGGTTATTTGATTCAATGTGAAAATTTTATATCCCACA CAACTAATGTAAAAAAGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 779072: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7790721702731AA140571MEEG0103.M1FSchistosoma mansoni, egg stage


Date: 3:42:49 on Sat 18 Nov 117.