EST 779073 is a singleton


Sequence

>779073 (1 EST) Length=433 AACCCTTTACTTCCCTTAGTTTCTTTGTTTTGTTGTATTTATCTTTTGTTATAGAGAACTATGCTTTTAATCATGTTTTT TTTTTTAAATTTCTGTTGGTTTCTGCAGCCTGATCTTGACCCCTTTGCTCATCACTCCTCCTTCTCTGTAACTGGATTCC AGGATATAGACTCAGTGTTTAGCTGTGGGTGTCTGCTTCTGCTTCCATCAGCTACTTGGATGAAAGCTTTAGGATGGCAT GTAAGGCAATCATCATTCTCATTATAGGGGAAGGGCATTTAAGGTAACCTTTTCACTTTTGCTTAGATTCTTAGTTGGGG TCATCCTTGTAGATCTCTGGACATGTCCCTAGTGCCATTTATATTAAACCAATAATGGCACTCTCAATTATAAGTATCTT TTCCATAACTATGCTGTATTCCCCCAAACCCGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 779073: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7790731702732AA140572MEEG0104.M1FSchistosoma mansoni, egg stage


Date: 12:54:16 on Sun 19 Nov 117.