EST 779075 is a singleton


Sequence

>779075 (1 EST) Length=430 AATATCACCTACTGTTTATTTATTTAGATATTTTTAACTTATGGGTTCAGAGAATTCATTTTCAATAAAGAACTAATATT CTTCACCTTCTTCATTTTCACCTTCGGCATCGACACTGTCCACACCAACTTCTTCATAATCTTTTTCTAAAGCTGCCAAA TCTTCACGAGCCTCCGAAAATTCACCTTCTTCCATACCTTCACCGACATACCAATGTACAAATGCTCTTTTAGCATACAT TAGGTCAAATTTGTGATCTAGACGTGCCCAAGCTTCAGCAATAGCTGTAGTGTTGCTTAACATACAGACAGCTCGTTGTA CTTTGGCTAAGTCACCACCTGGTAAAACAGTTGGTGGTTGGTAATTAATACCAACTTTGAATCCAGTTGGACCCCAGTCT ACAAATTGAATTGTTCCCCCGGGTTTTTAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 779075: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7790751702734AA140574MEEG0106.M1FSchistosoma mansoni, egg stage


Date: 6:34:3 on Thu 23 Nov 117.