EST 779076 is a singleton


Sequence

>779076 (1 EST) Length=219 GACAGTAAAAAGATTTATTTGAAGAGTTAAATAAGGTGAAGCAAGGTTGAATTCTAGTTATTACCGGAAAGGCATTGTGC AAATTATAAGCTTTGTAAAACAGCCGGAATGTGAATGTACTGATAGAAAAATTGATCGACGTTGAAATGAATTGAAAAGC ATGTTTGGCTTTCTTCAACCCACTTTCTATCAGTAGAAATAGAAGTATCCGAGGGGGCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 779076: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7790761702735AA140575MEEG0107.M1FSchistosoma mansoni, egg stage


Date: 10:53:13 on Tue 21 Nov 117.