EST 779077 is a singleton


Sequence

>779077 (1 EST) Length=304 TTAAAGGTGTTCTTGGTCGGTGGATTTCACCTGGTGATTTGGATGTTGAAATTAAAGACCGTTACCCTGGCTGTATGGAA GGTCGTGTACTGTATGTGATTCCATTCAGTATGGGTCCAATTGGATCACCATTGAGCAAAGTTGGGATTGAAATAACTGA TAGTATTTATGTTGTACTATGTATGATAATTATGACACGTATGCATCCAGATGTATGGAAAGTCATTGAATCCAAGAAGG AATTTGTCAGATGCGTTCATAGTGTTGGGTGCCCCACCTCTATCTCATCGTAAGTGTTAAGAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 779077: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7790771702736AA140576MEEG0108.M1FSchistosoma mansoni, egg stage


Date: 21:45:24 on Mon 20 Nov 117.