EST 779087 is a singleton


Sequence

>779087 (1 EST) Length=184 TCAAGGCTATCGATATCTATAAATCTCAATTTCCAGATAGAGTTCCTGTAAAATTCTATCCAACATTCGGTGAAATAATC AAACCATGGNAGCCACTACGCTGATTGTTTTTTCGACAATCATAAAAACTTTTAATATCTCANGTAATTAGTTTGAAATT GTGAATAGATCCATTGTTCAAAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 779087: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7790871702746AA140586MEEG0123.M1RSchistosoma mansoni, egg stage


Date: 14:20:40 on Mon 20 Nov 117.