EST 779091 is a singleton


Sequence

>779091 (1 EST) Length=186 GGCCCTGCCCTGTATGCATGACAGACTATGGACACCTCCATGGAGGGCCTCACCCTCCCTGGGGAAATGAGGGGATAATG GGGGGGTTGGGGGAGAGCATGGGAGTAGGGGAGGGAAAGGGAGAGGGACCTGGAACTGACTTGTGAAGCAACCTTGTTTC TTATCTAAATTTAAACTGAAAAATCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 779091: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7790911702750AA140590MEEG0127.M1FSchistosoma mansoni, egg stage


Date: 2:35:43 on Mon 20 Nov 117.