EST 779092 is a singleton


Sequence

>779092 (1 EST) Length=296 GATCGTAAACTATATCTGTTATACGAAGGTTAATGATGTTACCCACCTGCACAGGTAGATAGAAGCACAATACGCAATAA AATAAACTGACAGTCAACAACTCAAATCATTTAGATACGACTCCATAAACGAAGAAACATACAAACAATATTATTACCGA AGAGAAAGGCAACTCCAAATTAACGGTGGGTAGATGTAAAGTGTAGAAAGGTGACAAGAAAATCATCTCAAATCCACAAA TTTAAATGTATTCCATTGGTTAGTGAAATATCCAATAACAAGCAAAGTAAATTTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 779092: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7790921702751AA140591MEEG0128.M1FSchistosoma mansoni, egg stage


Date: 4:13:15 on Thu 23 Nov 117.