EST 779094 is a singleton


Sequence

>779094 (1 EST) Length=215 GGAACTCACTCTTGAAGACCAGGCTTGGCCTCGAACTCACAGANATCTACCCGTCTCTGCCTCCCGAGTNCTGGGATTAA ANGCGTGTTCCACCAACGCCCGGCCTTCTCCTGTTACCTTCTTTATGAAAAAATAAAATGTATTCCATTTATTCATTTTC TTGATGACAGTTTTGTTTTGTTTTTTGCCTGCATGTATGCCTGTCTNCTCGTNCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 779094: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7790941702753AA140593MEEG0130.M1FSchistosoma mansoni, egg stage


Date: 21:51:36 on Sat 18 Nov 117.