EST 779096 is a singleton


Sequence

>779096 (1 EST) Length=259 GTCCGAATATGTTTTATTTTGTGGAATAATTAGCAATTATATCCAAATATAAGTAGTATATATCTATACACCTAGTGTTA TTATTAGTAGTAGGAATAGTTTGTTTATTAACAAATTCATCGAAAGACAATGTACATACAGACAGTAACAACAACAAAGA CAGAGGTAAGAGACAAAGAAAGAAAATGAAAAAGAAAGATCCAGCCACTTTCAAAAAAATGGACCAGTTTCCGAGGGAAA GGTTATTCGTAATATTTGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 779096: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7790961702755AA140595MEEG0132.M1FSchistosoma mansoni, egg stage


Date: 11:58:39 on Fri 24 Nov 117.