EST 779097 is a singleton


Sequence

>779097 (1 EST) Length=402 CCTGCTGAATAGTACTCCATTGTGTAAATGTAGATTTCTTCACCTTCTTCTATACCTATTTTTCTTAGGTTTGATCTTTT CATGGTGTCCCATATTTCATGGATATTTTGTGTTAGGGATTTGTTAGACTTTAGATTTTCTTGGGNCAATGAATCTATTT CACCTAGTGTATCTTCAACACCTGAGATTCTGTCTTCCATCTCTTGTATTCTGTTGGTTATGCTTGTATCTGTAGTACCT GATNATTTGCCCAGCTTTTCTATTTCCAGCATTCCTTCAGACTGTGTTTTTATTGTCTCTATTTCAGCTTTCAACGCTTG TACTGTTTGAATTGTTTCTTGTAAGTTTTGCTTTGTCTTTCCCCCTCTTTCTTGCATTTGTTGAAGTTTTTGCTTTGTCT TT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 779097: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7790971702756AA140596MEEG0133.M1FSchistosoma mansoni, egg stage


Date: 10:45:12 on Tue 21 Nov 117.