EST 779098 is a singleton


Sequence

>779098 (1 EST) Length=242 CAGTCAATAATTATTCCAGCATCTCAAGTAGATAAATAACCTGAACACATTGTGATGAACTTGCATTTAATGAAATAATT TTAAAGTACTACTACAACTACAACAACAACAAAATAAATGTTAGTAAATGAACCGACAGTGTCCTTCCATCCTATTCTTT GAGTTACATGTAGACTCCATACTTGTGATCCACCTCTTCTTCCATTGCATCTATAACTGAGATGGACCCTTTCCATGGGA TT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 779098: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7790981702757AA140597MEEG0134.M1FSchistosoma mansoni, egg stage


Date: 23:36:7 on Sun 19 Nov 117.