EST 779099 is a singleton


Sequence

>779099 (1 EST) Length=453 CTTCCCGCAGGCCGACTCACCGGGAACGTGCACAAGCACGCGAAGACCCGGCGGGAAAGGAAGCCAAGCTCCCTAGCACA TCTCGCAGGAGCCCGGGACTGACTAAGCAATTAAAACTTGGGGACAAGTCCTCCCTGGAGGACACCGGCCCCAGGATCTT TCCAACCACGACAAATCCTCCAAAAGAAGAAAGCTGAGCTTAAGTTTACACACACACACACACAAAGTAAAAAGTTCCTC TAAGTGGAGGGAGGGAGATTAAAAAAAAAGTCACAATACCGACCTGAGTAACAAGGAGAGGAGGAGGCGTGTGACCTGCC CGGTCAGATTGCGTANTCCTCTATGTCTTGCTCTCTCAGTCTCTCCTTCTCTCTCTCTCTCTCTCTCTCTTTCCCTCTCC CTCTCTCAGTATTTTTTTTTACAGGGAATGCATTCTTTCTGAAAGTATCAAGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 779099: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7790991702758AA140598MEEG0135.M1FSchistosoma mansoni, egg stage


Date: 0:49:11 on Wed 22 Nov 117.