EST 779103 is a singleton


Sequence

>779103 (1 EST) Length=164 ATGGCCTGACCCTCTACAACGGCCGCCTGGCAAGCTTCATCCTCAATACAGTTCTTCACTAGTTTCCATACTGCCTTGGT CCCTATCCTTAGGTCTCTTTGCTCTAGGTGTCGATCAAGATCCCTCCCCAACTTATTCCATGATGCCAGGTTGAGAGAGC CAGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 779103: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7791031702762AA140602MEEG0139.M1FSchistosoma mansoni, egg stage


Date: 12:57:24 on Sat 18 Nov 117.