EST 779104 is a singleton


Sequence

>779104 (1 EST) Length=494 GGCACGAGGNTCAAATCATACCCACTCTGCAGAAAGAATTTGCTTTCTTTTGTTATTTTTACAGCTTGTATTATGGGATA CTGATATTATTATTTATAACACTTCTGGTTACATGAAAGTCAGGAAATCAGATATTTTGTTTCTTAAAAAGGAGAAAAAG AAATCATAAAATTATTGCTTTGTGATAGAAAATTCCCAGATGTGATTTACTGACACTCTCAACATGATTCATCTTGAGTA GGAGACTGCTCACCAACAGGATATGAGGTCCTCTTCCTAGAGAAAAGAACTTTCAGGCATTCATTTAAAGTTTGTGAAGG ACCTCTCTCCTCTACGTCTCTATGTGTGCCCCTCCACCTGAATCTCTATCAGTCTCTGTCTGTCTATCCCTATTTTCTCT TGCTCTTTTTCACTCACTATGTGTCACTCCGATTCTTTCTTCTATGTNATATCTCTGTGACACACAAGGTGCTTCTTTGT GTCTGTGTGTCAGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 779104: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7791041702763AA140603MEEG0140.M1FSchistosoma mansoni, egg stage


Date: 16:27:9 on Fri 17 Nov 117.