EST 779106 is a singleton


Sequence

>779106 (1 EST) Length=438 CTGCCGAATAGTACTCCATTGTGTAAATGTACCACATTTTCCCTGTCTACACTTTGGTTGAGGGGCATCTAGTTGCTTCC AAGTTCTGGCTATTACAAATAATGCTGTTATAAACATAGTGAAACAGACATCCTTGTTGTATGAATGGGAATCTTTTGGA TGAATTCCTAAGAGCGGAGTTGTTGGGTCTTGTGGTATGTTTATTCCCATTTTTCCGTGGAATCTCCATAATGATTTCCA AAGTGGATGTACAAGTTGGCACTCCCACCAGCAGTGGAGGAGTGTTCCCCTTTCACCACAACCTCTCCAGCATAAATTGT CATTGGTGTTTTTGATTTTAGCCATTCTGACAGGAGTAAGATGGTATCTCAGAGTTGTTTTGATTTGCATTTCCTGGATG GCTAAGGATGTTGAGCACTTTCTCAAGTGCCTCTCAGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 779106: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7791061702765AA140605MEEG0143.M1FSchistosoma mansoni, egg stage


Date: 21:11:40 on Sun 19 Nov 117.