EST 779108 is a singleton


Sequence

>779108 (1 EST) Length=650 GACAAGGCTGGTAGTGGGTCAGGACACGGTTGTCTGGGATCAGGGTGGACATACCCTCAGGTGAGCCGTCTGGGATGTTA CCTGCTAAATAAGACCAAGGACTGGGAGGGAGGAGGTATCAGGAGGGGAGGGGTGTGGGGCAGGAAGAGGAGGGAGGGCC AGGCAAGTGTTAGGAGGTGTTTGGGGTGCAAGGGGTCCAGGTTGGATGAATGCAGGGTCATAAGAGCAAAGGTGGGTTAG GGAATGGCCCTCCTTATCTCAAGTTGCCCCACAATCCTCAGCTGGAACACTCCCCAGCTGGCAGAGTTCCCAACTGTCTC ACATCCCAAACCATCCATCCCTTCTGCTCTTCCCTGATCTTTGAGATACCAGCTCTTATGACAAAGCAGACAAGGGTGAC TGCGGAGACAAACACCCCAGGCAGACAGAGCTTAGTGAGAAGTTTTATTAGAAAGGGGAAGGGGGGGGGGAGAGACACAG AGACAGAGAGGACAGAAGAGAAGAGGGAGACAGGAAAAGCCTTGTCTGCCCCAGGGGAACAGCAGGAAGGAGAGTGGGTG GGGGTCTGTCTTTTAAAAACCTGGTGCGCAGATTAGTAGTCATGGAACTGGCCTGGCCAGGGCACTGTCTGAGTGCATTC TGTCAGGTGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 779108: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7791081702767AA140607MEEG0145.M1FSchistosoma mansoni, egg stage


Date: 16:37:50 on Sat 18 Nov 117.