EST 779110 is a singleton


Sequence

>779110 (1 EST) Length=408 AAACTTATATTACATATTTTCACAATACCCAATCCGGAAACTCGATCTGGACGTCTTTACCCGTCAACTTTTTGTATAAT CCCGTGATAATTTTNAGCTTATGTTCTATGTAGTTTCTCTGTGCAACATCCAAGTNGGATTTGATTAAGGTACTTCCATC ACATCTGACTTGAATGCNTTTTCCTTCAATTTCAGCAGGGTAAACAAGATCTTTCAATATAGCTTCGTGCACAGCTGTTA GGGTCCTACTTCTAGGNCGCTTTTGCTTCGGATTAAATTTGCATTTTCTTTTAGGCTTTGCGATGATTCTTCGGAAAGCC AACAGCACAACATGAGGACCACGGAGCTTCTTTTCGAGCTCGCCTACGAGTCTGTTATGTATAAACTGGTATGTCCGTAG TTGTGGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 779110: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7791101702769AA140626MEEG0147.M1FSchistosoma mansoni, egg stage


Date: 19:14:6 on Sun 19 Nov 117.