EST 779111 is a singleton


Sequence

>779111 (1 EST) Length=342 TGGTGATTTTNANGCAGTTTTGAGAATTACAGGTTAGAGGGTCAGANAGGAAGCCAAATAAAATGACTTGCTTCTGAACC CATTTTAGGAGATCAGAGAGCAGTTCTCCTCGACGTGAGAGGAAGAAGAGCTCAAAGAAGAAGAAACACAGGTATGAGGT GGAAAAGGTTTTTNTTTTGTTTTGTTTTTCGAGACAGGATTTCTTTGTGGCTTTAGAGGCTGTCCTGGAACAGTTCTTAT AGACCAGGCTGGTTTCAAACTCACAGAGATCTGCCTGCCTCTGCCTCCCGAGTGCTGGAATTAAAGGCGTGTGCCCCACC ACGACCCGGCTAGAAAGTTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 779111: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7791111702770AA140627MEEG0148.M1FSchistosoma mansoni, egg stage


Date: 17:21:41 on Fri 24 Nov 117.