EST 779112 is a singleton


Sequence

>779112 (1 EST) Length=454 GCAAATCAACACCCAGTTTATTTTTAATGATTTTATATTGATACAACAGCATATTACCATATTTGTAAAATAAATACAGG TAAGACACAAAAATACTTGCTATTTATGAATGAAGTTAGGTATGGTTTTTTCACATTATCAAAGACAAGTTAGACCTAAA TTGTACAAGATAAAGTATATTACACATAAATCTTATGGATTCAAATTNGGGGCTCGATTACAGCCCCATCTACAGCACCG GCGATAGGTACAATCAGGTTATCCTTACTCATGAGATTGTATTTTAATACAAATGTGGTAAACCTTCGACATAATGCAGT TGATTCTTCAAAAGAATCAAATATCTCTCGATGATGATAATAAGCATGAGAGAATATTCTATAAACACGACGGCAAACAG AATCAAGACGATTAACTGCCGAAACTTTGATGCTTACTCTATAATGGTAAACAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 779112: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7791121702771AA140628MEEG0149.M1FSchistosoma mansoni, egg stage


Date: 15:4:1 on Fri 24 Nov 117.