EST 779113 is a singleton


Sequence

>779113 (1 EST) Length=268 GAGCAGATGTTGATCTAGATGTCCCAGTCAGGGCTGAACACTCAACAGTCACTTTTACCCTTTGATAAGGTGCAAGTCTC TGANTTAAGCATTCCTCGCTGCAAACTGANACTTTTCTGACTAAAGTTGACAGCAGCACAAATCTACAGCCATAAATACA AGTACTAAGTTAGATGGCCATTGGNTCCATTGGACAACATGATTATCTTGCAGAACCATAGTGGGTTCCCCTCTAAAGCA TGACTTCCGTGACCAAGGGCTTTTGGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 779113: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7791131702772AA140629MEEG0150.M1FSchistosoma mansoni, egg stage


Date: 1:18:44 on Mon 20 Nov 117.