EST 779114 is a singleton


Sequence

>779114 (1 EST) Length=288 CAAGCAGAAAATTCATAATCGTATTTATTTATATAACATTATATGTGCATTCTTATATGACTTAAAGTGAACTCATTCAT TCTTCTATATGCACTGCTTGCNAACGTAGCTATGACAAGTAAAAGNTTTATGAATTATAAAGGAGAACTATGGAAAGAGA TAAGATTATCGTGGTATGATACTAATTAAGGATGTGTAGTTTACTGTAATTTTGGGCGATTTGTGCCTAGGTAGCATAGT TAGTTGATCAGTAAATAGATTATCACATAGATAAACAAAAGAGGTGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 779114: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7791141702773AA140630MEEG0151.M1FSchistosoma mansoni, egg stage


Date: 5:4:25 on Sat 18 Nov 117.