EST 779127 is a singleton


Sequence

>779127 (1 EST) Length=320 AAAGAGCTAGACACTGTGTAGTCTGTGGTTCAGCTGCATTGGGAGATAGGGCAAAAGGATCACTTGAATCCAGGATTTGG AGTGAACCTGAGTTCTATCTCCTGTTCGCACATCAAAAGTCAGGCATGGTGATATATTCTTACAGTCCCAGAGGCAAAGA GGCAGAAACAGGTAGGCCCCGTCCCTAGTGATTGCTGGTCAGACAGTCTAACTTAAAATATAAAAACCCAGATCTCAGAA AGAGAAGATGTCTCAAAAACTAAGACCAATGGGCTCCTGAGCAATGAGACTGACTCCCAGATTCCACGTGCATGAGTATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 779127: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7791271702786AA140562MEEG0221.M1RSchistosoma mansoni, egg stage


Date: 5:1:17 on Sat 18 Nov 117.