EST 779134 is a singleton


Sequence

>779134 (1 EST) Length=247 CAGATTAGCAATTTATTGATATAATTTGGTTGAAGGCAAACAAATATTGCAGATGATTAANATAATAAGAGAATGACAAC ATGTTTTGCACATACACAAAAATTAATTAAACAATGTTGAGAGTTTTGATAATGATAAACTGTCGATTGTCCAAACGACC AGCTCCATATCATCATCATCACCATTATTGAGGCATATATTTAAGGNACTCTGATATCAAATCCAATGTTTGGGTAAACA ATGGGTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 779134: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7791341702793AA140569MEEG0234.M1FSchistosoma mansoni, egg stage


Date: 16:9:46 on Tue 21 Nov 117.