EST 779136 is a singleton


Sequence

>779136 (1 EST) Length=218 TCGAGGAAGGAGAATCATCAATGGCATCTCACTTCAACAAATTAGCCACAGTGTTTACACTGCAGGTCCGCAGCCTGGAC TCGCTTGTGTTTCAAGANATTCCCAGGATTCTAATGGTTTTCCAACTGGGAGGGTTTTGATGCTGTGTATTTAATTTCTC TGCCTTAGCACACATGATTCCTTATGATGCTGCTAGACGCTTAAAGCAGAATCCCAGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 779136: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7791361702795AA140609MEEG0236.M1FSchistosoma mansoni, egg stage


Date: 11:34:53 on Fri 24 Nov 117.