EST 779139 is a singleton


Sequence

>779139 (1 EST) Length=209 CCGATTTTAATTGTATTTAGTACAATCTGTGCGGNCTACCCATAGTACTTTTGATGTACAAACATCTGACGTTTTGCCAA TTCTTCTTTAGTAGCGTTACGAGAAAGTTTATTGACAAGTTGATGTTTTGAGCTAGCNCCTCAGGAGTCATCTTCACGTG ACCAACAGNGACATTCAGANAAAGGGACCTTCTTCATCTGGAACTTGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 779139: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7791391702798AA140612MEEG0240.M1FSchistosoma mansoni, egg stage


Date: 23:54:45 on Fri 17 Nov 117.