EST 779140 is a singleton


Sequence

>779140 (1 EST) Length=612 GGCACGAGATCTAATTTAACATCAGTTCCATCATTACTACAACCGGCTACTGGTGTTGGACCAATGAAGTTGACGACGAC GACAATGAATAAACCAAAACCTGTTGATATAACAAATACTTTAATATCATATAATGTGAATGCAATCAATAGCACATCTG ATATGATGAATAAATCTACTACACAACCAAATCGTATAGGTACAGGTATACCTTTGGCTTTAATCACACCACCAACTACT CAACACCAATCATATGAAAAGAACGGTGTTTTCGATAATAATAACTCTCTGTATTATCATTCGAATAATAATGTTGAACA GTTACAATCAACTATTTTACCTAAATCAATTATTCCACACAATAGTAGTAATAATTTTAACTCATTGAATTCTATACCAT TTTCTCCAACAATTCTAATATGATGAGACTGTTCAACAACAACAACCTATTCCAAATGCATGACATATCAATTATTCCCG ACAACATCATCCATTACAATGCCAACACCAATGTTTAATCAAAATGTATCCAATTCTAATAATCTAATAAAACCATTATC TAAATGTGAGATAGATGATTTATTAAGCTGACAATGAATTCATTCTTTTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 779140: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7791401702799AA140613MEEG0242.M1RSchistosoma mansoni, egg stage


Date: 17:11:32 on Thu 23 Nov 117.