EST 779141 is a singleton


Sequence

>779141 (1 EST) Length=377 GGCACGAGATTTGTTGGGGTAAACATAACATTCTTCCCTCAACACTTCTTAGGGCTAGCAGGAATACCACGACGCTATTC TGACTACCCAGATGCTTATACTATATGAGNNACTGTGTCATCAATAGGATCTTTTATCTCACTAACAGCCGTGCTTGTAA TAATCTTTATAATCTGAGAGGCTTTCGCTTCTAAGCGAGAAGTTCTCACAGTAGACTATTCCTCAACGAACCTAGAATGA CTTCACGGTTGTCCTCCCCCCTATCATACATTTGAAGAACCTACTTTCGTTAAAGTAAAATAAATGAGAAAGGGAAGGAT TCGAACCCCCTAAAATTGGTTTCAAGCCAACTCCATAACCTCTATGTCTCTCTCAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 779141: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7791411702800AA140614MEEG0245.M1RSchistosoma mansoni, egg stage


Date: 12:5:48 on Fri 24 Nov 117.