EST 779142 is a singleton


Sequence

>779142 (1 EST) Length=174 GGCACGAGTCTAGCCTCCTTTTCTTGGTTTTTTGAGGCAGAATCTCACTTTTATAGCCCAGGCTAGTTTGGAACTCATTA GTTGCTCAGGCTAACCTTGAACATTTGGCAATCCTCCTGCCTCAATCTTCCAAGTCCTGGGATTACAGGCATGTGCTACC ACATTTAGCAAAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 779142: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7791421702801AA140615MEEG0247.M1RSchistosoma mansoni, egg stage


Date: 11:51:57 on Fri 24 Nov 117.