EST 779143 is a singleton


Sequence

>779143 (1 EST) Length=264 GGCACGAGAGATGATACCCCTTAGTGAAANTCTTATTCAGGTTTGGGCTGTGAATAAGTCTATACCTAATCCAAGCTTCG TAGAACCTGTAAAAGTAACAGATGAGGAGATTGATGGAGAAACTAAACCAGAATTTAAAACGGATGAGAACGATGAGTGT GAGGCAATTAGGAAGGAAGAGACTATGGATACAGATATTAATGAGTCACAAAACTGATTCATCCTTTTTTGGTTGCTTTT GTCAATAATATAAATTACTGATAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 779143: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7791431702802AA140616MEEG0248.M1RSchistosoma mansoni, egg stage


Date: 9:51:12 on Fri 24 Nov 117.