EST 779147 is a singleton


Sequence

>779147 (1 EST) Length=275 ACTTTTAGCCAAGCTGTCTTTTGCCCAAATGTGTGTATTGAGTTTGTCAGTCTTGATTTAAACACACAAATCCGCCAGAA GGGAAGAGGCTGCCTCTTTGGATAGCATATGCATTGAATGCCAGGATAAATACTGCTACCTGCTTCCGTCCGTACTTTTC CAAGTAAGTCAGTGTAGAATTGCTCACTCATCTGTCAAAGTGTCATCCTTCATTAACAGCAAAAGAGCCATTGTTTTTCA AACTTGGCACACATGAGGTACTTTATCATGGGGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 779147: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7791471702806AA140620MEEG0252.M1RSchistosoma mansoni, egg stage


Date: 19:27:5 on Sun 19 Nov 117.