EST 779148 is a singleton


Sequence

>779148 (1 EST) Length=392 GAAGTTCTTGAAACATAAATTTTAGGAGAAGACTTATCACTATATGTTTCACAACATATATATTTTAATCTTCCAATTAA TGCCATCACATCCCTCCAGCAAACAAAAACTAAACAGTTAATAGAATGTTCAATGAAATGAATCCATTCACAGTTCATAA AATGGGATTGTGCCCTTGATCGATTGTCTATTGTCCAAAAAATAACGTTTAATCTATACCTATTTCGTTTTAAATCTTGC ATGTGCAAATATTTTATTGAAATAAACAAGGAAACTGATTTTTTCCTGTATGTCATTCGACTGAGCATAGATTGTCTCCT GAAACTTCGGTAGTANTGGTTAGAATGCCATAATTAGCTGTATTTTCATCACTAATACTTACNTTTTAACTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 779148: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7791481702807AA140621MEEG0253.M1RSchistosoma mansoni, egg stage


Date: 6:48:26 on Tue 21 Nov 117.