EST 779150 is a singleton


Sequence

>779150 (1 EST) Length=165 AGAGAACTAATATCTTGTTCTTTTGTTTTGTTTTGTTTTTCCTTTTTATGAGAGGACTTAGCCTGTAATTGCCCTTTCTG TAATATCTTTGTCAGGCTTCAGTATGGAGACTCTGCTAGACTCCCAAGACAAACTGGAAAGTGCTGTGCATTCATCATTT ACAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 779150: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7791501702809AA140623MEEG0255.M1RSchistosoma mansoni, egg stage


Date: 19:19:17 on Sun 19 Nov 117.