EST 779151 is a singleton


Sequence

>779151 (1 EST) Length=260 CTTTTCCTTCTGTCTGGCTTCAAATTACTATACCTTGGGAAATGCGGTGATATATTTCTAGGGATGTCTATTGGTGTTTT GATTTCTTAATTATGAAATGTTATTTTAATTTAGGGAGGCAGAGGAGGAACCAAAAAAAAAAAAAAAAAAAAAAAAAGCC AGCCAAATCCAAACTTCTTGACCAAAGACCGTCATCTTTGCACCAACCCTATACAAAGGCCTCTATTGGTCAACTGTGAG GGGCACCACTGATTGTCAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 779151: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7791511702810AA140624MEEG0256.M1RSchistosoma mansoni, egg stage


Date: 0:12:58 on Sun 19 Nov 117.