EST 779152 is a singleton


Sequence

>779152 (1 EST) Length=305 TAACAGCTGTCCTTTAATCTATAACCGGCCGCAATGAGTACTGTCCTTGTTTAGATTATTCGATTTGTTTATTTCCCCAT TTACTTTCAGTTGCTTATGTACCCATCCACATAAATACACAAATAACTATATGCTTATACTACCTACTCCTCTCTATCAT TCTTTCTTTATAATTTCTTGCATATTCAATCTACCTATCTGTCGTACTCCTCACTTATGACAGAGTTTGATACCCTATAA CNTAATCTTATTATATTAATGAATATTTTAACTGTTTTGTTAGAACGGTATAANAAATGGGGTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 779152: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7791521702811AA140625MEEG0258.M1RSchistosoma mansoni, egg stage


Date: 14:32:49 on Tue 21 Nov 117.