EST 780795 is a singleton


Sequence

>780795 (1 EST) Length=375 ATGGATTCTGCCGTTTATGGATGCGGTATTNTCTGGTNCGGNTTTTTACTGATACCTATGATTGCACTGACACGCGATNT TGCTTGGAAAATGGCTAAACGTGTTACAGCTGGTTCATTACGTGAACAAGTTATGCAAATGGAACAAATGCAAGTTGATC CAGGTCGTTTGATTCGTGCCAGTNTTCGTCCAAAATCTACTGATCGTTCCGNGTTTGTGCGGNTTATGCGTAGNAGTATG GGTTCACAGGCATTGCTTAATCTTTGGTCTTGGCGCTAGTGTNCGTACAAATACAGCATCACCGACACCCATAACAGATT CTCGNGAAAACAGATCATGGTTATGCATTTTNCTCAAGAAGGACATGGGGNAGNC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 780795: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7807951705390H98300SMNHADA016039T3SmAW


Date: 4:44:42 on Wed 22 Nov 117.