EST 780804 is a singleton


Sequence

>780804 (1 EST) Length=366 CATTGATCGGGCTTCAGGAGCAGACGAAGGAAATGGTAAACAGTTTACTTCATCCATCACAAAGTGTGACTCGTNCAAAC TTAGTTCGCCGACTGACTGATTTCTCGTTACTGTATGAAATGGAAGGATATGAACAGGACCCTGTAATATCTGATGCAGA TGAAGAGCACTATGATACGATGGATTTGAGTGGTGGAGTTGATAGCAGAACTGAGCGTAGCATACCAGACGATTGAAGCA ATTGCATCCANCTATTCTNATGTGATATTGATAAAACANCACTTTTTATTTCCATCCCTTAATTTGGGNCAGTCTTATTT ACTTCCNCATAAAACATNTNCAAGTTTCGGTTCAAAGNCAAACGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 780804: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7808041705399R95615SMNHADA017086T3SmAW


Date: 14:39:54 on Sun 19 Nov 117.