EST 780808 is a singleton


Sequence

>780808 (1 EST) Length=367 TATGGGGGCATCTATTGGAAAAGTTTTAAATNACTTATATATAGNTGACCATGGTGAAAGCAACAACTGATTCTAATCTC AAGAAAGCTAAGATTACGTGCATGTTATCGCCAACCCAAAAACCTCCGAAACCTAACCCTCACTGGAAACACCTTGGAGC TTCAGAAACCAGGTGAAGAGTTACGTTTAAGCAACCTCAAGGCTGGCGCAAAGTTCATNCACGAATCCAGATGTAGTCGG GAAAATATTGCTGTGATAATTGAACCANACAATCATGAATCTGCAGCTTTTTATTATTACATATTCCACTATTTNANGTG GGACTACCTGTAGCATTANCTCGAAAAGCTGTTATGAAATGTNGGAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 780808: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7808081705403R95613SMNHADA017074T3SmAW


Date: 16:45:27 on Sat 18 Nov 117.