EST 780827 is a singleton


Sequence

>780827 (1 EST) Length=261 TCATCATCAGATNATGNAATATGGATGGTTTGATAAAATGGATGATATGATGAAAAATTTAGAAGATCATCATCATTATC GTCGTCATCATTACCCAAAAGAACATCATTAATGTTATCACTAATTCTCTGATAANCATTCTCTGACAGTGAGGTATTCC CTGTNGTNGAAATCTCGATNTATGGTAAGTATAAACCTCTAAGAAAAACTACCATTCTTANTGTCCGNNATGAAAATANT CATAGATTTANCTATACCAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 780827: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7808271705422H98394SMNHADA015075T3SmAW


Date: 23:1:52 on Wed 22 Nov 117.