EST 782375 is a singleton


Sequence

>782375 (1 EST) Length=233 AACCCTTGTNTAGCTACCTAAACTAACTAACGATTAATTTAAGCATTAACTTAAACTAACCCATAAACTTAAGAAAGCAT ATTAAAANGNATCAAACAATGACTTGGGNGAACAAGGAGACAAGTCAATCAACTTTCGGTACAATGCAACCCAACCTTGA ACCCTCAATAAATCCCTAATTAATAACGGATTTAACCAAACAAACCAAAAAGACTCCTCAATAAAAGATACAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 782375: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7823751713213AA143808MCCE0101.M1FSchistosoma mansoni, cercariae


Date: 2:32:58 on Thu 23 Nov 117.