EST 782387 is a singleton


Sequence

>782387 (1 EST) Length=267 GGCAGTTAAAACATATATTTCATATAGATATTACAATGCAAGCAAAAATTATGGCACAGAGGTCCATTAATTTTTAATTA CTGGCCAGCTTGGTTTCTGAGGAGTACATAAACTTGTTCTTTGATCCAGTTTTTATGATGTGGAACATATGTGTATGTAG ATTCATGAAAAACTAGACAACTAAGGTCAGCCAACTGATCGATGAACTGGAAAAGTTGACGGTATGTCATAAGTGATAGT AGGAGCATTAGGTTTTTCACGTTTTAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 782387: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7823871713225AA143820MCCE0117.M1FSchistosoma mansoni, cercariae


Date: 2:31:57 on Wed 22 Nov 117.