EST 782412 is a singleton


Sequence

>782412 (1 EST) Length=425 GAAATAACTTTATGATGANATTATTCACTCTTTTTATAACATATTTTTATCAGGAATTCGATAAAATAATGATAAAGAAT ACACGAATGATTATTATTAATAGCAAAAAAAAACTTAGTTAACTAAGTAGATGAAACAAAAAAAATCAAACCAACTAACC AAATCAAAAAGTCATAATAAAACAAAATGGACAATGTAACAATACCGTAGATGACAAACACCAATTCAAGACAATAAAAG TNAAAGAAAAGAGGAAAAAAGAATCTAACATTGATTTTCTCTCTCAGTTTTCCTCCTAGAAAAAAAGGGTGTAAAAGTTG TAACTAATAGTTGATAAATTTACTAATATTTTTTTAAAAATTGAATCGTATTACATTAGTAGATTTGTTTGTATCCAAAT GTTATGAGACTGAACATTTACTGGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 782412: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7824121713250AA143845MCCE0215.M1FSchistosoma mansoni, cercariae


Date: 2:41:49 on Fri 24 Nov 117.