EST 782425 is a singleton


Sequence

>782425 (1 EST) Length=428 ATTAAAATTAACTAATATTTACAAGGAAATATTATACATTTTAAAAAGAAAACTTTTACTCCATGTCAATATCTTCTTCA CTTCCTGAATCTGATTCACTGCAGGTCAAATCGTCAGCATCAGTCGTTTGGTCTTGAGGTAAACACTGATTAAGATTACA ACCAGTTGTTAGCTTGTCTATTTTATCCTGAAGTTCGTGAGTGTTTTTATTTCTAAAAAGAAGAAGTCCTTCGTATATTA GACGTGCAACTTCTTCATGAGAGTTGTCTTCACAAATAATATTTAGTTCATCATCTAAATAATCTTCCAGAAAGTCGCTT ATTTCATCCTCATGTTTGGACTTCAAAATAACCTGAGGCAGATGTTCATACAATAATCCAACTTTCTGTTGTGTATTTGG GCCTCCAGACTCCTGATTTAGACCAAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 782425: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7824251713263AA143858MCCE0237.M1FSchistosoma mansoni, cercariae


Date: 2:50:9 on Sat 25 Nov 117.