EST 782430 is a singleton


Sequence

>782430 (1 EST) Length=262 CTGTTTTATCTATTTATTTATTTATTGAATTATTGATTGATTGGTTGATTTAGAAAGACATTATTGTCTTTATTGTTATT TTTATTATTATTAGTAGTAGTATTAGTAGTAATATTAGTATTATTAATATTTTGTAGCCATATGTGCAAATGAAACAATT GGCATTATTTTATTTACATACCTATACACATAGAAAAATAACTGAATCTATACAATAAGAATTGTAGAAAACATATTTAG TGTAACACAAATTATTTCTGAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 782430: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7824301713268AA143863MCCE0243.M1FSchistosoma mansoni, cercariae


Date: 8:56:33 on Mon 20 Nov 117.