EST 782431 is a singleton


Sequence

>782431 (1 EST) Length=306 CAAACTTTAACTGATCATTATTTTGTTAAACTGACTCACCACCATGTAATTGATATCGGCCTTCTACTCACCTATGGAGC ATACATATATACACGCACGTACTCAGAGACACAGTAGCGTCTAATGAATACAAGAATGCAACACCAATATCATTTGAAGA AAACAATCAAAAATATAAATGTCAGATGCATCTCTTTTAGTTTTCTGAGAAAACAGTCGTTGAACTTTCGTTAGTACAAA AAAATAATTAGGTAACATTATCCATATCAGTAGTTGTTTAATTNCATATTATTAGTNAGAAGTAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 782431: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7824311713269AA143864MCCE0244.M1FSchistosoma mansoni, cercariae


Date: 16:50:29 on Wed 22 Nov 117.