EST 782438 is a singleton


Sequence

>782438 (1 EST) Length=251 AGTAATCGTAAATATTTATTTAGAAATTCATATCAGTACTGAAATATGTAAACATTTTTGTAATGTTACCATTGAATCAC TGAAATTTTTATATAATGGTAATATTCATGAATATAACCAAGATGTTTCAAATAAGTATAATCGTCTTCACTTTCTCACT TCTATTGGTTCATCATAATGAAATTCTTTGACAGGAGACCAACGTTTATCGTAGAATTTAGGGCGTTTTTTCACCTTCAA GNGGGCCATCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 782438: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7824381713276AA143871MCCE0254.M1RSchistosoma mansoni, cercariae


Date: 10:10:6 on Wed 22 Nov 117.