EST 782442 is a singleton


Sequence

>782442 (1 EST) Length=382 AATGAATACACTTCCCAACCTCTTCCCCTATTGTCATTTAGTCCAGTTAGTAGTTTGAAAAAAATGGACAATAACTTTTT CGGCTGATGATTTTAAAAAATAAAATTATTCTCTGCTTTCCTTTACATATTAATCTATTTTCAACCTTCAATTTCATTAT CATTGGTATATTCATGCGATAAATATTTTATGTAGAGAATATTTTTAATTCCCTTATTCTGGTCTTATCAAATTACCAAT AACTCGTTAATTATGACTGCTATATGTTATTCTTATTCAGTATGTCTTCAATTCGTAATGTAATGCTTGGATTAGATCTG ATGAAAATAAATACCTCAATATAAGTCATGATTANCACACTGGGATCGAATATGTCCATCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 782442: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7824421713280AA143875MCCE0261.M1RSchistosoma mansoni, cercariae


Date: 22:52:10 on Wed 22 Nov 117.