EST 782445 is a singleton


Sequence

>782445 (1 EST) Length=580 CAACTATTGACCGATTGGAATGATATTACACGAAATGGCTATTTTCACGGTTTTGATTGGTTTGTTTGGATAGTGATATT TCTACATGCATTCGGTGGTTTATTAGTAGCTTTAGTAGTTAAATATGCCAACAATATTCTTAAATCATTCGCCTGTTGTG TGTCAATTATTCTATCATGTGCATTCTCTGTTGTATTTCTTGGGATGCATTTAAGTAATAGTTTCATTTTTGGCACATTA ATTGTTATCGTATCATCTATTCTGTATTCTAGTTACCCTCCGAAAATAAATGCTCGATAGAAATTCGTATTACTGCTTTT CATTAATTTAACAATCTTACAATAATTTCAATCTTTTTTTGTCTAACTCGACACTTGACCTCCCAATATTTTGTTTACAT ATTTCAAACTACTTTTAAGTAGTATAAGTGAGCCTGAAATTTCAGAGAGAACCAGTCTTCATATTTGTTCATTCTTTAAA ATTTTTTTTTGAAATTCTTTTTCCTCAGGAAATTCCAAGTTGAGCTTCCGTTAAAAACTATGTTAATTATCTTCATAGTA GCTTTTATATTTTNCGTATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 782445: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7824451713283AA143878MCCE0266.M1RSchistosoma mansoni, cercariae


Date: 0:47:40 on Wed 22 Nov 117.